Hello -
Regarding your question about crossing an intron with the upstream
primer - the reason that this prevents amplification from the genomic
DNA rather than from the reverse-transcribed cDNA is fairly simple -
consider the amplification of the cDNA (sequence is arbitrary):
<----- primer -----> extension will easily occur here as the
primer
ACGACGACGACGACGACGAC binds completely to the template
||||||||||||||||||||
TGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGC
^
|
splice site (where an intron would be if this was genomic
DNA)
now consider what would happen if the primer were to anneal to the
genomic DNA, two cases to consider - 1: if the primer anneals to the
DNA before the intron:
<----- primer -----> extension will not occur as the primer
does not
ACGACGACGACGACGACGAC anneal at the 3' end
|||||||||||xxxxxxxxx
TGCTGCTGCTGAGCAGCAGCAGCAGCAGC............CTGCTGCTGCTGCTGCTG
^
|
splice site (where an intron is)
2: the primer is unlikely to anneal with the 3' end past the intron
because of the small footprint of the 3' end of the primer which will
basepair (remember, the melting temperature of a double strand of DNA
is related to the number of bases which are complementary - the fewer
bases, the less stability to the duplex, the lower the melting
temperature, and a greatly reduced chance of binding - this is why
most primers are > 18 bp)
<----- primer -----> not likely to
bind
ACGACGACGACGACGACGAC too few
basepairs
xxxxxxxxxxx|||||||||
TGCTGCTGCTGAGCAGCAGCAGCAGCAGC............CTGCTGCTGCTGCTGCTG
^ ^
| | splice site (end of
intron)
|
splice site (where an intron begins)
A nice discussion on primer design for RT-PCR from Qiagen:
http://www.qiagen.com/literature/brochures/pcr/pdf/pcrcha19.pdf
Another nice discussion on avoiding DNA contamination from Ambion:
http://www.ambion.com/techlib/tb/tb_176.html
A question on a website related to this issue:
http://micro.nwfsc.noaa.gov/protocols/methods/RNAMethodsDocs/9-2002/9.6.02.1559.html
Ambion's top 10 list of pitfalls to avoid with RT-PCR:
http://www.ambion.com/techlib/basics/rtpcr/topten.html
As to what other steps in the procedure prevented DNA contamination, a
quick look at the Titan RT-PCR spec sheet:
http://biochem.roche.com/pack-insert/1939823a.pdf
reveals that the Titan kit does not contain any other factors to
prevent DNA amplification (such factors might include purifying poly-A
RNA first, using a chemical extraction techinique which favors RNA
over DNA, cesium chloride density-gradient centrifugation to
selectively purify RNA versus DNA). Therefore, control reactions must
be performed to exclude the possibility of DNA amplification. These
reactions can be of a few types:
1) No RNA in sample - should give no product - the standard negative
control
2) No RT step - there should therefore be no cDNA and any
amplification signifies the presence of contaminating DNA
3) sample treated with RNase, then RT-PCR - this is the definitive
negative, should destroy all RNA in the sample preventing any RT
reaction - once more, any amplification results from contaminating
DNA.
As to whether or not rRNA or tRNA will interfere - it is unlikely as
these will not anneal to the primers, therefore they are not involved
in the reaction. In extreme cases (where the level of the transcript
of interest is very, very low), the quantity of rRNA and tRNA can
alter the chemistry of the reaction due to non-specific effects and
kill the RT-PCR reaction. In cases such as these, purifying mRNA (via
oligo-dT binding to the poly-A tail of mRNA) will remove these
hinderances.
Please let me know if you have further questions.
synarchy
Search strategy
RT-PCR primer design
titan rt-pcr |
,
0 Comments
)