ASSIGNMENT INTRODUCTION
This assignment will allow you to look up and assimilate information
pertaining to chemotherapy. You should answer the questions below
pertaining to chemotherapy and its effect on the cells of the body.
SITES TO USE IN COMPLETING THE ASSIGNMENT
Part of the assignment is finding appropriate sites to answer the
questions below. To help direct you with your search I have given you
of few sites which you shoud find very useful. They are:
http://www.cancer.org/docroot/home/index.asp
http://cancer.med.upenn.edu
You are responsible for citing the websites used to answer each of the
following questions, so please keep track of your sites as you are
reviewing the material. Printing a hard copy of the material may help
aid you with this.
THE ASSIGNMENT
You should answer the questions below. You may use any written or
online source that is appropriate. Please make a notation of the
source used to answer each question. PLEASE NOTE: IF YOU DO NOT MAKE A
NOTATION OF YOUR SOURCE, YOU WILL NOT RECEIVE CREDIT FOR YOUR ANSWER.
What is the definition of cancer?
How does this relate to the cell cycle?
How does chemotherapy work? Which cells of the body are targeted?
Why do patients undergoing chemotherapy lose their hair and have
problems with their digestive tract?
What are other options for patients with cancer to rid their body of
cancerous cells?
SUBMISSION GUIDELINES
Don't forget to include your name on the top of the assignment. Submit
along with your other assignment as ONE file. Put the questions first,
and then put this assignment. Questions to answer from the text
UNIT 2 QUESTIONS
1. Define or describe energy, and explain the relationship between
potential and kinetic energy.
Energy is less tangible than matter. Energy has no mass, does not take
up space, and can be measured only by its effects on matter. Energy is
defined as the capacity to do work, or to put matter into motion. The
greater the work done, the more energy used. A fast pace runner uses
more energy than a jogger in a short period of time. Here are four
different forms of energy: Chemical, Electrical, Mechanical, and
Radiant or Electromagnetic. Energy has two existing forms or work
capacities. Both are transferable to one another. Kinetic energy is
energy in action, it can even be seen in the tiniest particles of
matter (atoms) as well as in larger objects such as a bouncing ball.
It does work by moving objects which in turn do work by pushing or
moving other objects. Potential energy is stored energy, that is
inactive energy that has potential or capabilities of doing work but
is currently not doing so. The batteries in an unused toy have
potential energy but are not using it. Leg muscles are doing the same
when your sitting on the couch. When potential energy is released, it
becomes kinetic energy.
2. Two of the forms of phosphorus are called P-31 and P-32
a. How are they similar to one another (atomically)?
b. How do they differ from one another (atomically)?
c. What are the members of such a group of atoms called?
d. Why are some of the atoms that show these differences (like P-32) important in
medicine?
3. Mrs. Roberts, in a diabetic coma, has just been admitted to Noble
Hospital. Her blood pH indicates that she is in severe acidosis, and
measures are quickly instituted to bring her blood pH back within
normal limits.
(a.) Define pH and note the normal pH of arterial blood.
(b.) Why is severe acidosis problematic?
4. A physiologist observes that the concentration of sodium inside a
cell is decidedly lower than that outside the cell. Yet sodium does
diffuse easily across the plasma membrane of such cells when dead, but
not when they are alive.
Which of the following terms applies best to this cellular function
that is lacking in dead cells?
Osmosis, Diffusion, Active Transport (solute pumping), or Dialysis.
Explain your choice, and explain why this function is lost when the
cells die.
5. The external faces of some of the proteins in the plasma membrane
have carbohydrate groups attached to them.
What role do such ?
sugar-coated?
proteins play in the life of the cell?
6. Differentiate clearly between primary and secondary active transport processes.
7. Explain why alcoholics are likely to have much more smooth ER than
teetotalers (people who do not drink alcohol).
8. What is an oncogene? Using the web or any other source, name one.
Be sure to identify the source of your information.
9. DNA is composed of two strands, but only one of them contains your
actual genetic code. What are the names given to the two strands, and
what is the difference between them?
10. Below is a DNA sequence on one strand (we?ll call it the ?top?
strand). Figure out the DNA sequence for the corresponding
(?bottom?) strand. (hint: Replication)
AGGCCATTAGCCCTATTCGGGTATAAATGG
11. If the bottom strand from question 10 is transcribed into RNA,
what is the sequence of the mRNA?
12. Based on the mRNA you found in 11, what is the sequence of amino
acids for this peptide? |
